Document Type : Original Article (Special Issue)

Authors

1 Institute of Genetic Engineering and Biotechnology, Baghdad University, Iraq

2 Al-Manara, College for Medical Sciences, Misan, Iraq

3 College of Medical, Misan University, Misan, Iraq

4 USDA, Agricultural Research Service, Animal Genomics and Improvement Laboratory, Beltsville, MD 20705-2350, Iraq

5 College of Medical, Basrah University, Basrah, Iraq

Abstract

Generalized Vitiligo (GV) is a complicated disease with many factors that can influence its severity. The GV pathway and its severity are influenced by genetic, epigenetic deleted the comma, and environmental factors. Many genes have been identified at the genetic level that may be involved in this type of disease. As a result, the primary goal of this project is to investigate the impact of some SNPs in the promoter region of the NLRP1 gene. A total of 50 GV patients and 2504 healthy controls were recruited to see if single nucleotide polymorphisms (SNPs) in the NLRP1 gene (rs925595, rs925596, rs 925597, rs925598, rs11569898, rs2716936, rs79376273, rs1156990, rs8072203, and rs2670642) contribute to determine the relationship between GV and these SNPs, the data was statistically analyzed. Three SNPs (rs1156989, rs925595, and rs925597) showed a significant association with GV among ten tested SNPs. The three SNPs were found within a linkage disequilibrium block. Haplotypes H3, H8, H9, and H10 which included rs1156989, rs925595, and rs925597 were found to be associated with GV. The findings suggest that NLRP1 polymorphisms are linked to GV development.

Graphical Abstract

A Comparative Study of NLRP1 Gene for Iraqi Vitiligo Patients with 1000 Genomes

Keywords

Main Subjects

Introduction

Autoimmune diseases are a group of physiological disorders with highly diverse pathogenesis and clinical manifestations that affect more than 5% of the global population [1]. Vitiligo is a depigmenting skin disorder characterized by the selective loss of melanocytes, resulting in pigment dilution in the affected areas of the skin [2]. The disease is classified based on the distribution and location of white spots. The two most common types of vitiligo are segmental and non-segmental vitiligo and they are distinguished by the distribution of lesions on the skin [3]. Non-segmental vitiligo (GV), an acquired chronic depigmentation illness, is distinguished by symmetrical white patches on both sides of the body. Segmental vitiligo (SV) lesions are distinguished by their asymmetrical distribution and distinct dermatomes (skin areas supplied by individual spinal neurons) [4, 5]. Both men and women are affected, but women and girls are more likely to seek assistance due to the greater social impact on them [6, 2]. The majority of people develop NSV between the ages of 10 and 30, but it can occur at any age [2]. Significant progress has been made in our understanding of GV pathogenesis and it is now clearly classified as an autoimmune disease associated with genetic and environmental factors, as well as metabolic, oxidative stress, and cell detachment abnormalities [7]. The goal of this study was to see if NLRP1 variation is associated with the risk of generalized vitiligo in a cohort of patients from the Iraqi population. Thus, the researchers genotyped 10 SNPs spread across the NLRP1 gene region in 50 patients with generalized vitiligo and 2504 matched non-vitiligo controls.

Materials and Method

Sample collection

A blood sample (5ml) was collected from (50) GV patients who were referred to dermatology clinics at various hospitals in Iraq. The genomic study population (50 GV patients) was compared to a control group of DNA sequences from 2504 individuals that made public by the 1000 Genomes Database project (https://www.internationalgenome.org/about) [8]. Individuals from the 1000 Genomes Project declared themselves to be healthy at the time they took part in the project study.

SNPs identification

The data slicer interface tool (https://www.internationalgenome.org/data-slicer/) was used to skim the variants data of the NLRP1 promoter region for a total of 2504 individuals from the 1000 Genomes database for the controls genotype identification. Supplementary S-1 contains the complete list of SNPs, their coordinates, and genotype results. The frequency of occurrence of each SNP allele was plotted and is depicted in Figure 1.

Figure 1: SNPs mapped in the promoter region of the NLRP1 gene, and the allele occurrence of each SNP as reported in the 1000 Genomes Project (1000 genomes)

Whole genomic DNA was extracted from blood sample for NLRP1 patients using a Promega genomic DNA extraction kit. Polymerase Chain Reaction (PCR) was used to amplify the NLRP1 gene promoter region from each sample. The genomic region (2156b) was amplified and the Sanger sequencing method was used to identify each SNP genotype from the GV amplified product.

Primers

Three primers were used (http://bioinfo.ut.ee/primer3-0.4.0/primer3/). Forward primer (ATCCCAGTAAGAGACGACTG), a reverse primer (CTGTGTTCCTCAGATTCTTCC) and internal primer (GAATCTGCAAGATGCCAATG) were designed around region that contains all ten SNPs (rs925595, rs925596, rs925597, rs925598, rs8072203, rs2670642, rs1156989, rs2716936, rs1156990, and rs79376273). The genomic region was amplified at 2156 base pairs (Figure 2).

Figure 2: structure of NLRP1 gene (121,198pb)(Snapgene)

Linkage Disequilibrium (LD) mapping

The LDmatrix tool (https://ldlink.nci.nih.gov/?tab=ldmatrix) was used to analyze the likelihood of the six most common SNPs mapped in the NLRP1 promoter being inherited together as a haplotype. Figures display the generated graphical LD heat-map [3, 4].

The used software rSNPBase as a database for curated regulatory SNPs

Statistical analysis

The GV - (allele, genotype, and haplotype) association were estimated using Fisher's exact test described by [9]. The R statistical package (https://www.r-project.org/) was used to calculate odds ratio and confidence intervals for each selected variant and their haplotypes combinations (Figure 3).

Results and Discussion

Genetic markers on the NLRP1 gene are thought to play a role in the susceptibility to autoimmune diseases like GV. Many published studies examined the relationship (or lack thereof) between a single nucleotide polymorphism (SNP) on the NLRP1 gene and GV. To validate previously studied SNPs and include a larger pool of SNPs, the promoter region polymorphism of the NLRP1 was investigated in this study for its association with generalized vitiligo, as indicated in Table 2.

The genotype occurrence pattern of ten SNPs was investigated in a group of 50 generalized GV patients and a population of 2504 individuals from the 1000 Genomes Project (Phase 3). The genotype pattern and allele frequency of these ten SNPs located in the promoter region of the NLRP1 gene are demonstrated in Table 2.

Figure 3: Heatmap matrix of pairwise linkage disequilibrium of 10 polymorphisms in the NLRP1 gene https://ldlink.nci.nih.gov/?tab=ldmatrix

 

Table1: rSNP Base a database for curated regulatory SNPs

SNP_ID

rSNP

LD-proxy of rSNP(r2>0.8)

Proximal regulation

Distal regulation

miRNA regulation

RNA binding protein mediated regulation

eQTL

rs1156989

yes

yes

Yes

No

no

No

No

rs1156990

yes

yes

Yes

No

no

No

No

rs2670642

yes

yes

Yes

No

no

No

No

rs2716936

yes

yes

Yes

No

no

No

No

rs79376273

yes

no

Yes

No

no

No

No

rs8072203

yes

yes

Yes

No

no

No

yes

rs925595

yes

yes

Yes

No

no

No

No

rs925596

yes

no

Yes

No

no

No

yes

rs925597

yes

yes

Yes

No

no

No

No

rs925598

yes

yes

Yes

No

no

No

No

 

Table 2: Genotype and allele distribution of ten polymorphisms in GV patients and 1000 Genomes

SNP

Genotype

GV

1K Genome

Odds Ratio

P- Value

rs1156989

TT

8 (17.3 %)

986 (39.3 %)

(reference)

 

T/C

TC

26 (56.5 %)

1125 (44.9 %)

2.85 (1.28 -6.32)

0.0084

 

CC

12 (26 %)

393 (15.6 %)

3.76 (1.53-9.28)

0.0045

 

T

42 (45.6 %)

3097 (61.8 %)

(reference)

 
 

C

50 (54.3 %)

1911 (38.1 %)

0.51 (0.33-0.8)

0.0022

rs2716936

CC

35 ( 76% )

1851 (73.9 %)

(reference)

 

C /A,T

CT

9 (19.5%)

576 (23 %)

0.83 (0.39-1.73)

0.72

 

TT

2 (4.3 % )

77 (3 %)

1.37 ( 0.32-5.82)

0.65

 

C

79 (85.8 %)

4278 (85. 4 % )

(reference)

 
 

T

13 (14.1 %)

730 (14.5 % )

1.03 (0.56-2.04)

1

rs79376273

GG

42 (93.35)

2184 (87.2 %)

(reference)

 

G /T

GT

2 (4.4 %)

291 (11.6 %)

0.36 (0.09-1.48)

0.229

 

TT

1 (2.2 %)

29 (1.15 %)

1.79 (0.24-13.47)

0.44

 

G

86 (95.5 %)

4659 (93 %)

(reference)

 
 

T

4 (2.2 %)

349 (6.9 %)

1.610341 (0.60-6.0)

0.5263

rs1156990

GG

7 (15.5 %)

323 (12.9 %)

(reference)

 

G/A,C,T

GA

14 (31.1 %)

989 (39.4 %)

0.65(0.26-1.63)

0.44

 

AA

24 (53.3 %)

1192 (47.6 %)

0.93(0.40_ 2.18)

0.82

 

G

28 (31.1 %)

1635 (32.6 %)

(reference)

 
 

A

62 (68.8 %)

3373 (67.3 %)

0.93169 (0.57-1.48)

0.821

rs8072203

CC

41 (91.1 %)

2183 (87.1%)

(reference)

 

C/T

CT

1 (2.2%)

290 (11.5 %)

0.18 (0.03-1.34)

0.082

 

TT

3 (6.6%)

31 (1.2 %)

5.15 (1.51-17.53)

0.027

 

C

83 (92.2%)

4656 (92.9 %)

(reference)

 
 

T

7 (7.7%)

352 (7.02 %)

0.8964468 (0.41-2.31)

0.6799

rs2670642

CC

2 (4.5%)

304 (12.1%)

(reference)

 

C/T

CT

16 (36.3 %)

985 (39.3 %)

2.47 (0.58-10.80)

0.27

 

TT

26 (59 %)

1215 (48.5 %)

3.25 (0.77-13.78)

0.09

 

C

20 (22.7 %)

1593 (31.8 %)

(reference)

 
 

T

68 (77.2 %)

3415 (68.1 %)

0.6305679 (0.36-1.05)

0.08227

rs925595

GG

8 (17.7 %)

1131 (45.1 %)

(reference)

 

G/C

GC

10 (22.2 %)

1050 (41.9 %)

1.35 (0.53-3.42)

0.63

 

CC

27 (60 %)

323 (12.8 %)

11.82 (5.32-26.26)

1.64E-11

 

G

26 (28.8 %)

3312 (66.1 %)

(reference)

 
 

C

64 (71 %)

1696 (33.8%)

0.20(0.12-0.33)

1.402e-12

rs925596

GG

2 (4.5 %)

10 (0.3 %)

(reference)

 

G/A,C

GA

2 (4.5 %)

140 (5.5 %)

0.07 (0.01-0.58)

0.03

 

AA

40 (90.9%)

2354 (94 %)

0.08 (0.02-0.40)

0.01798

 

G

6 (6.8 %), 88

160 (3.1 %)

(reference)

 
 

A\c

82 (93 %)

4848 (96.8 %)

13.75158 (8.91-20.94)

2.20E-16

rs925597

CC

11 (25 %)

986 (39.3 %)

(reference)

 

C/G,T

CT

15 (34 % )

1123 (44.8 %)

1.20 (0.55-2.62)

0.69

 

TT

18 (40.9 %)

395 (15.7 %)

4.08 (1.91-8.73)

0.00025

 

C

37 (42 %)

3095 (61.8 %)

(reference)

 
 

T

51 (57.9 % )

1913 (38.1 %)

0.4484893 (0.28-0.70)

0.000231

rs925598

CC

14 (31.8 %)

1668 (67.8 %)

(reference)

 

C/T

CT

8 (18 %)

647   (25.8 %)

1.47 (0.62-3.53)

0.47

 

TT

22 (50 %)

159 (6.3 5)

16.49 (8.27-32.85)

1.79E-14

 

C

36 (40.9 %)

4043 (80.7 %)

(reference)

 
 

T

52 (59.0 %)

965 (19.2 %)

0.1653244 (0.10-0.25)

4.75E-16

 

Wang et al. (9) proposed that, in addition to CD8 + T cell-mediated killing, the activation of the NLRP1 inflammasome, which leads to increase IL-1 synthesis and release, could be a cause of melanocyte loss at the edges of GV lesions. Capase-1 activation via the inflammasome pathway further causes pyroptosis and inflammatory cell death. Exogenous and endogenous stimulation of the NLRP1 inflammasome causes acute lung injury in mice, increasing caspase-1 activity towards its downstream substrates and mediating the onset of pyroptosis. One can speculate that NLRP1 inflammasome-mediated apoptosis via caspase-1 is another mechanism for melanocyte destruction, which will be an interesting future research direction [10].

NALP1 variants have recently been linked to GV in Caucasian patients from the United States, the United Kingdom, and Romania [11]. The Middle East has a genetically distinct population. To the best of our knowledge, no comprehensive genetic studies on GV patients from the Middle East have been conducted, and none have looked into the role of NALP1 as a risk factor for GV [12].

The table shows the results of the association between the allele and genotype frequency of the ten selected SNPs and the GV [2]. Five SNP allele frequencies (rs1156989, rs925595, rs925596, rs925597, and rs925598) were significantly (p 0.05) associated with the occurrence of GV disease (0.0022, 1.402e-12, 2.20E-16, 0.000231, and 4.75E-16, respectively). Regular SNPs, which are not only typically found in 5′-upstream regions, but can also be found in transcribed regions and 3′-downstream regions, have an effect on transcription rates [13].

The significant association of the C allele (rs1156989 T/C) with the occurrence of GV is also reflected in the genotypes that carry that allele. The heterozygous TC genotype of rs1156989 is linked to the occurrence of GV, with the odds of having TC genotype in people with GV being 1.85 times higher than in people from the 1000 genomes project (Healthy). The homozygous alternative allele genotype CC of rs1156989 has an even stronger association than the heterozygous genotype; the association of having CC genotype is 2.76 folds stronger in people with GV than in people from the 1000 genomes project.

The rs925596 SNP follows a similar pattern, with the mutant allele a being significantly linked to the GV occurrence. The A allele is dominant (the allele is associated with the disease even if it is polymorphic), as is the C allele of rs1156989, but having homozygous AA or heterozygous GA in rs925596 is associated with a lower risk of GV occurrence. The likelihood of having the GA genotype and AA is slightly less 1 but still significant (p 0.05), indicating an association of these two genotypes with healthy individuals from the 1000 genomes compared with GV patients.

The rs925595, rs925597, and rs925598 loci were found to be recessively linked to GV. The mutant allele of each of the aforementioned variants was associated with a higher risk of GV only when found to be homozygous (P 0.05). The CC genotype of rs925595, the TT genotype of rs925597, and the TT genotype of rs925598 are all linked to an increased risk of developing GV (odds ratio = 11.82, 4.08, and 16.49, respectively). In the United States, the United Kingdom, and Romania, Jin et al. conducted extensive studies on NLRP1 variations in GV patients. Specific single nucleotide polymorphisms (SNPs) of NLRP1 have been found to increase susceptibility to GV, including rs6502867/A, rs961826/A, rs925598